WWW.KONF.X-PDF.RU
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции
 

Pages:   || 2 | 3 | 4 |

«ИЗУЧЕНИЕ ТОЧЕК РАЗЛАДКИ ТРИПЛЕТНОЙ ПЕРИОДИЧНОСТИ ПОСЛЕДОВАТЕЛЬНОСТЕЙ ДНК, КОДИРУЮЩИХ БЕЛКИ ...»

-- [ Страница 1 ] --

Федеральное государственное бюджетное учреждение наук

и

Центр «Биоинженерия» Российской Академии Наук

На правах рукописи

Суворова Юлия Максимовна

ИЗУЧЕНИЕ ТОЧЕК РАЗЛАДКИ ТРИПЛЕТНОЙ

ПЕРИОДИЧНОСТИ ПОСЛЕДОВАТЕЛЬНОСТЕЙ ДНК,

КОДИРУЮЩИХ БЕЛКИ

03.01.09 - математическая биология, биоинформатика



ДИССЕРТАЦИЯ

на соискание ученой степени кандидата биологических наук

Научный руководитель доктор биологических наук, профессор Коротков Евгений Вадимович Москва – 2015 Оглавление ВВЕДЕНИЕ 

.

Актуальность проблемы 

Степень научной разработанности проблемы. 

Цель работы

Задачи исследования. 

Личный вклад автора 

Научная новизна 

Теоретическая и практическая значимость работы 

Положения, выносимые на защиту 

Методология и методы исследования 

Достоверность научных результатов 

Апробация работы 

Публикации по теме диссертации

Глава 1. ОБЗОР ЛИТЕРАТУРЫ 

1.1  Определения спектра научных работ для обзора 

1.2  Краткий обзор задач и методов компьютерного анализа последовательностей ДНК 

1.2.1  Методы анализа последовательностей, не основанные на выравниваниях 

1.3  Определение периодических последовательностей

1.4  Методы исследования триплетной периодичности 

1.5  Гипотезы, объясняющие свойство триплетной периодичности .... 41  1.6  Применение свойства триплетной периодичности в программном обеспечении для анализа нуклеотидных последовательностей .............. 44  1.7  Образование гибридных генов в результате объединения или вставки кодирующих последовательностях генов 

1.8.  Методы исследования гибридных генов 

.

1.9.  Математические методы, использующие точки разладки для изучения биологических последовательностей 

1.10.  Выводы из литературного обзора 

.

Глава 2. МАТЕРИАЛЫ И МЕТОДЫ 

2.1.  Поиск точек разладки триплетной периодичности в нуклеотидных последовательностях. 

2.1.1.  Математические принципы, лежащие в основе алгоритмов поиска точек разладки. 

2.1.2.  Мера различия частотных матриц 

2.1.3.  Создание искусственных последовательностей 

2.1.4.  Уровень значимости меры различия частотных матриц. ............ 62  2.1.5.  Алгоритм поиска точек разладки 

2.2.  Поиск парных точек разладки в нуклеотидных последовательностях. 

2.2.1.  Определение парных точек разладки 

2.2.2.  Мера подобия матриц триплетной периодичности 

2.2.3.  Поиск парных точек разладки в последовательности ................. 68  2.2.4.  Разделение случаев одинарных и парных точек разладки .......... 71  2.2.5.  Выбор уровня значимости для поиска парных точек разладки .. 71  2.2.6.  Алгоритм поиска парных точек разладки 

2.2.7.  Построение контурных диаграмм различия триплетной периодичности 

2.3.  Изучение однородности триплетной периодичностью .................. 74  2.3.1.  Модели и гипотезы распределения триплетной периодичности  75  2.3.2.  Исследование распределения триплетной периодичностью внутри генома 

2.3.3.  Распределение различий триплетной периодичностью между геномами 

2.3.4.  Изучение геномной специфичности триплетной периодичности ...

   

2.4.  Программная реализация используемых алгоритмов 

Глава 3. РЕЗУЛЬТАТЫ 

3.1. Результаты поиска точек разладки триплетной периодичности ...... 81  3.1.1.  Результаты анализа искусственных последовательностей ................ 82  3.1.2.  Результаты обработки банка данных KEGG 

3.1.3.  Поиск подобий, подтверждающих склейку, в последовательностях с точками разладки 

3.1.4.  Изучение влияния аминокислотных повторов на точки разладки триплетной периодичности 

3.1.5.  Исключение из результатов высокогомологичных последовательностей 

.

3.1.6.  Анализ функций кодируемых белков 

3.1.7.  Сравнение с границами доменов и известными склейками ........ 93  3.2.  Результаты поиска парных точек разладки триплетной периодичности 





3.2.1.  Результаты обработки искусственных последовательностей ..... 98  3.2.2.  Результат поиска парных и одинарных точек разладки ............ 100  3.2.3.  Анализ последовательностей с парными точками разладки ..... 103  3.3.  Распределение триплетной периодичности бактериальных геномов     

3.3.1.  Распределение триплетной периодичности внутри геномов .... 108  3.3.2.  Распределение триплетной периодичности между геномами .. 110  3.3.3.  Попарная классификация геномов по типу триплетной периодичности 

3.3.4.  Обсуждение результатов изучения распределение триплетной периодичности бактериальных геномов 

ЗАКЛЮЧЕНИЕ 

ВЫВОДЫ 

СПИСОК ЛИТЕРАТУРЫ 

ВВЕДЕНИЕ

Наступившая “постгеномная” эра ассоциируется с продолжением экспоненциального роста объемов геномных данных и с увеличением значимости биоинформатических методов. Новый рост данных в первую очередь связан с усовершенствованием технологий секвенирования и появлением секвинаторов новейшего поколения, которые обеспечивают высокую производительность на фоне значительно сократившейся стоимости процесса чтения генетической информации. Благодаря этому банки данных биологических последовательностей, такие как GenBank [Benson и др., 2004], UniProt [Consortium, 2009], KEGG [Ogata и др., 1999] и другие достигли очень больших размеров. Объемы данных ежегодно добавляемых различными институтами и группами в эти базы данных растут. При этом скорость понимания смысла этих последовательностей пока значительно отстает от скорости их накопления. При таком потоке данных обработка их без использования компьютерных программ уже давно невозможна. По-прежнему потенциал последовательностей используется не в полной мере. Потому новые технологии секвенирования требуют создания новых методов дальнейшей обработки и хранения полученной информации. Это означает, что в настоящее время разработка новых методов извлечения информации из последовательностей является особенно, актуальной задачей.

Конечно, биохимические методы являются наиболее предпочтительными при анализе биологических последовательностей.

Однако, они имеют высокую стоимость, требуют значительных временных затрат и могут быть направлены только на конкретные, тщательно выбранные цели. В то время как выбор таких целей, а также анализ результатов и выявление закономерностей давно стали задачами компьютерных методов. Компьютерные методы позволяют использовать достижения компьютерной промышленности (в том числе высокопроизводительные суперкомпьютеры) для решения биологических задач (in silico) [Ventura Di и др., 2006]. К одним из основных типов задач компьютерного анализа последовательностей ДНК относятся исследования, направленные на изучение происхождения генов. Понимание механизмов эволюции последовательностей может дать ключ к созданию новых искусственных белков.

В настоящее время среди методов компьютерного анализа последовательностей основой (стандартом де-факто) являются методы анализа последовательностей, основанные на выравниваниях. Такие методы для некоторого исследуемого гена находят наиболее похожую последовательность (или семейство последовательностей) и на основании их сходства делают выводы об эволюционных и биологических свойствах исследуемой последовательности. Методы такого типа разрабатываются уже довольно долгое время, их точность и скорость работы достигли высоких показателей и постоянно совершенствуются. Однако эти методы не лишены недостатков и основной недостаток заключается в том, что если для исследуемой последовательности не удается найти “похожую”, то такие методы оказываются бессильны. В последнее время все чаще появляются работы, посвященные созданию альтернативных методов анализа последовательностей, не основанных на выравниваниях (так называемые, alignment-free методы)[Vinga, Almeida, 2003].

Изучение однородности последовательностей ДНК и разделение последовательностей на однородные участки в соответствии с определенными свойствами проводится достаточно давно. Примером тому может быть выделение изохор, отделение кодирующих участков от некодирующих и так далее. Такие методы используют статистические свойства последовательностей, используются также методы, основанные на выравнивании. Параллельно с этим с середины 1950-х годов развивалась, так называемая, теория точек разладки (change-point theory), впервые возникшая в контексте контроля качества на производстве. Задача о разладке состоит в определения позиции изменения статистических свойств последовательности или ряда. Такие изменения отражают внутренне изменения исследуемого процесса, детектируемые математическими методами. Позже некоторые из этих методов были также применены к последовательностям ДНК [Braun, Mller, 1998]. Большинство методов, изучающих однородность последовательностей ДНК, работает на уровне геномов. В то же время возможно и существование неоднородностей на уровне отдельных генов, на что указывает сложная структура многих кодирующих последовательностей.

Свойство триплетной периодичности известно уже довольно долгое время [Konopka и др., 1987; Shepherd, 1981a; Trifonov, Sussman, 1980;

Tsonis, Elsner, Tsonis, 1991]. Триплетная периодичность характеризуются неравномерным распределением символов в различных позициях кодонов. Эта периодичность отсутствует в некодирующих областях генома и интронах. За время изучения феномена триплетной периодичности были разработаны различные математические методы для ее исследования и сложилось несколько гипотез, объясняющих ее существование [Herzel и др., 1998]. Различные вероятности нуклеотидов в различных позициях кодонов были предложены в работе [Gutirrez, Oliver, Marn, 1994] в качестве математического обоснования триплетной периодичности. Триплетная периодичность нашла свое применение в компьютерных программах анализа последовательностей ДНК. В основном она используется для отделения кодирующих последовательностей от некодирующих, например, в работе [Fickett, 1982].

Триплетная периодичность может использоваться для изучения однородности на уровне отдельной кодирующей последовательности.

Точки разладки триплетной периодичности соответствующие позициям изменения этого свойства в последовательности могут отражать эволюционную структуру данной последовательности. Исследование, посвященное классификации триплетной периодичности, [Frenkel, Korotkov, 2008] показало, что триплетная периодичность большинства известных белок-кодирующих генов может быть отнесена к одному из примерно 2 500 классов. Очевидно, что полученное значения числа классов намного меньше общего числа известных генов. Этот факт позволяет предположить, что если некоторый ген был сформирован, например, в результате объединения последовательностей двух разных генов, триплетная периодичность которых значительно отличалась, то на границе будет присутствовать точка разладки триплетной периодичности.

Актуальность проблемы Вопрос о происхождении современных генов и белков исследуется уже много лет и является одним из фундаментальных вопросов. В процессе эволюции геном в целом и кодирующие последовательности в частности подвергаются различным типам мутаций: таким как вставки и делеции (как отдельных символов, так и довольно протяженных участков), а также замены одних символов на другие. В случае, если изменения затрагивают кодирующие участки, это может привести к различным исходам: мутация может оказаться незначительной и не изменит функцию белка; или напротив мутация может оказаться летальной для данного гена – белок окажется неспособным к выполнению своей функции; возникновение стоп-кодонов в последовательности приведет к образованию, так называемых, псевдогенов. И наконец – наиболее интересный вариант – появление в результате мутации белка с новыми свойствами.

Считается что, на определенном этапе эволюции дальнейшее усложнение происходит не за счет создания новых, а за счет комбинации более мелких существующих элементов. Различные виды хромосомных перестроек могут приводить к образованию так называемых гибридных генов, состоящих из частей ранее независимых генов. Гибридные гены могут образоваться в результате объединения (склейки) двух ранее независимых генов или их частей (далее будем называть такие гены склеенными) или посредством вставки одного гена или его фрагмента внутрь другого.

Изучение нуклеотидных последовательностей в настоящее время очень актуально, так как дает возможность получить принципиально новую информацию. В качестве такой новой информации могут выступать данные о местах склеек генов или их фрагментов, которые были осуществлены в ходе эволюции. Программы, основанные на выравниваниях, которые в настоящее время, используются в качестве основного инструмента для компьютерного предсказания мест склеек, имеют свои ограничения. Эти ограничения, прежде всего, связанны с поиском предковых последовательностей в банках данных из которых могли образоваться гибридные гены. Предковые последовательности могут отсутствовать в базе данных либо потому, что еще не были секвенированы, либо потому, что были утеряны в процессе эволюции.

Кроме того, они могли настолько измениться в процессе эволюции, что не опознаются существующими программами. Потому дополнительные методы, которые могли бы предсказывать места склеек генов или фрагментов генов без использования дополнительной информации в виде баз данных, имеют большое значение.

В качестве методов для поиска мест склеек можно предложить методы обнаружения точек разладки триплетной периодичности в нуклеотидных последовательностях. Задача о разладке состоит в нахождении точки изменения статистических свойств последовательности. Такие изменения отражают внутренне изменения исследуемого процесса, детектируемые математическими методами.

Впервые они были разработаны для контроля качества на производстве.

Позже некоторые из этих методов были применены к последовательностям ДНК. Примером тому может быть выделение изохор, отделение кодирующих участков от некодирующих и т.д. Все эти методы используют статистические свойства последовательностей без использования выравниваний. Большинство работ по поиску точек разладки посвящены изучению неоднородности последовательностей ДНК на уровне геномов. В то же время существование неоднородностей возможно и на уровне отдельных генов, так как в генах существует так называемая триплетная периодичность. Она отсутствует в некодирующих областях генома и интронах. Триплетная периодичность характеризуются неравномерным распределением нуклеотидов в различных позициях кодонов. Точки разладки триплетной периодичности в последовательности, могут отражать эволюционные изменения, приведшие к формированию данной последовательности.

Исследование, посвященное классификации триплетной периодичности, показало, что триплетная периодичность большинства генов может быть отнесена к одному из примерно 2500 классов. Это позволяет предположить, что если некоторый ген был сформирован, в результате вставки или склейки двух последовательностей, триплетная периодичность которых значительно отличалась, то на границе будет присутствовать точка разладки триплетной периодичности. В этом месте статистические свойства триплетной периодичности будут резко меняться. Это означает, что можно разработать математические алгоритмы по поиску таких точек разладки в генах. Найденные таким образом точки разладки триплетной периодичности будут предсказывать существование в местах разладки склеек генов или их фрагментов. Эти данные могут помочь в выстраивании картины эволюционной изменчивости генов. Полученные таким образом данные могут быть применены для создания искусственных гибридных генов.

Степень научной разработанности проблемы.

Уже несколько десятилетий известно, что последовательности ДНК, кодирующие белки, обладают свойством триплетной периодичности. За это время разработано большое число методов для ее определения, такие как корреляционные методы, методы, основанные на динамическом программировании, преобразовании Фурье, вэйвлетпреобразованиях, информационные методы и некоторые другие.

Триплетная периодичность нашла свое применение в компьютерных программах анализа последовательностей ДНК, таких как в программы для поиска генов эукариотических и прокариотических геномов. Все разработанные методы для поиска точек разладки в генах основаны на установление факта наличия или отсутствия триплетной периодичности на данном участке последовательности, а не на определение различия триплетной периодичности двух участков. Математические методы по сравнению триплетной периодичности у отдельных районов генов ранее не были разработаны. Поэтому для поиска точек разладки требуется разработать метод, позволяющий изучать изменения триплетной периодичности вдоль некоторой последовательности. Также ранее не было ничего известно о существовании точек разладки триплетной периодичности в реальных последовательностях генов.

–  –  –

Задачи исследования.

Для достижения поставленной цели был определен следующий список задач:

1. Разработка математического метода для поиска точек разладки триплетной периодичности в кодирующих последовательностях ДНК с учетом возможного сдвига рамки считывания

2. Разработка и тестирование программного обеспечения, реализующего метод поиска точек разладки триплетной периодичности в кодирующих последовательностях ДНК с учетом возможного сдвига рамки считывания.

3. Обработка при помощи разработанного программного обеспечения кодирующих последовательностей банка данных KEGG.

4. Изучение найденных случаев точек разладки триплетной периодичности посредством поиска подобий в банке данных Swiss-Prot.

5. Разработка метода поиска парных точек разладки триплетной периодичности в кодирующих последовательностях ДНК с учетом возможных сдвигов рамки считывания.

6. Разработка и тестирование программного обеспечения, реализующего метода поиска парных точек разладки триплетной периодичности в кодирующих последовательностях ДНК с учетом возможных сдвигов рамки считывания

7. Изучение при помощи разработанного метода поиска парных точек разладки триплетной периодичности кодирующих последовательностей 17 бактериальных геномов.

8. Исследование распределения триплетной периодичности генов внутри одного генома и генов, принадлежащих разным геномам. С целью оценки того, какой процент генов при склейке генов или их фрагментов может привести к появлению точки разладки триплетной периодичности.

Личный вклад автора

1. Разработка алгоритмов поиска одинарных и парных точек разладки триплетной периодичности в кодирующих последовательностях ДНК.

2. Разработка и тестирование программного обеспечения, реализующего алгоритмы поиска точек разладки в кодирующих последовательностях ДНК.

4. Отладка параметров работы программ поиска точек разладки триплетной периодичности при помощи имитационного моделирования.

3. Создание версии программы поиска одинарных точек разладки триплетной периодичности в кодирующих последовательностях ДНК для параллельной обработки на вычислительном кластере. Обработка реальных биологических последовательностей из банка данных KEGG.

4. Анализ связи найденных случаев точек разладки триплетной периодичности с различными биологическими причинами с использованием известных программ.

5. Разработка и тестирование программного комплекса для сравнения триплетной периодичности генов, принадлежащих одному геному, и генов, принадлежащих разным геномам.

Научная новизна

Данная работа обладает научной новизной, так как в ее рамках:

1. Впервые разработан математический поиска одинарных точек разладки триплетной периодичности в кодирующих последовательностях ДНК с учетом возможного сдвига рамки считывания и реализующее его программное обеспечение.

Загрузка...

2. Впервые разработан алгоритм поиска парных точек разладки в кодирующих последовательностях ДНК и реализующее его программное обеспечение.

3. Впервые показано существование множества одинарных и парных точек разладки триплетной периодичности как в генах прокариот, так и в генах эукариот.

4. Впервые проведено исследование распределения триплетной периодичности на множестве генов, принадлежащих одному геному, и разным геномам.

Теоретическая и практическая значимость работы Теоретическое значение работы состоит в демонстрации того факта, что триплетная периодичность белок-кодирующих последовательностей ДНК неоднородна на протяжении одной последовательности и может содержать статистически значимые точки разладки, как одинарные, так и парные. Эти точки разладки указывают на возможность существования склейки фрагментов ДНК в данном месте гена. Это означает, что разработанные методы имеют предсказательную функцию.

Практическое значение созданных алгоритмов, программного обеспечения и полученных результатов состоит в следующем.

Разработан метод поиска одинарных и парных точек разладки триплетной периодичности кодирующих последовательностей ДНК и реализующее его оригинальное программное обеспечение.

Исследование одинарных точек и парных точек разладки триплетной периодичности в кодирующих последовательностях ДНК может быть использовано для поиска генов, образованных в результате вставки или склейки. Исследование таких последовательностей может дать ключ к более глубокому пониманию эволюции генов. Новый метод поиска склеенных генов может дать информацию о том, как формируются новые белки в процессе эволюции и дать возможность для разработки новых методов создания искусственных ферментов. Возникает возможность объединения фрагментов генов в тех позициях, которые были уже использованы в ходе эволюции для создания гибридных генов.

Специфичность триплетной периодичности к определенному геному может быть использована для поиска генов, появившихся в геноме в результате горизонтального переноса.

Положения, выносимые на защиту

Метод поиска одинарных точек разладки триплетной периодичности с учетом возможного сдвига рамки считывания в белоккодирующих последовательностях ДНК.

Метод поиска парных точек разладки, на основании мер различия и подобия матриц триплетной периодичности с учетом возможного сдвига рамки считывания в белок-кодирующих последовательностях ДНК.

Исследование однородности триплетной периодичности генов, принадлежащих одному геному и генов, принадлежащих разным геномам.

Методология и методы исследования Теоретические основы исследования составили научные труды широкого круга отечественных и зарубежных ученых в области анализа символьных последовательностей. В диссертационной работе для решения поставленных задач использовались следующие методы исследования: методы теории вероятностей, математической статистики, методы теории информации и методы математического моделирования.  Достоверность научных результатов Достоверность полученных результатов основана на использовании методов математической статистики и тестировании разработанных алгоритмов с использованием модельных объектов с заранее известными свойствами. Достоверность также проверялась путем сравнения полученных результатов с результатами, полученными ранее как теоретическими, так и экспериментальными методами.

Апробация работы Основные результаты, представленные в данной диссертационной работе, докладывались на следующих конференциях: международной конференции “Новые информационные технологии в медицине, биологии, фармакологии и экологии”, Гурзуф, Украина. 2010; III и IV международных конференциях “Математическая биология и биоинформатика”, Пущино, в 2010 и 2012 годах; Четвертой международной конференции для молодых ученых “Молекулярная биология: достижения и перспективы” Киев, Украина, 2011; Школеконференции молодых ученых “Фундаментальная наука для биотехнологии и медицины-2011” Москва, Россия; Конференции «Методы математической физики и математическое моделирование физических процессов», проводимой в рамках «Научной сессии НИЯУ МИФИ-2012» Москва, 2012; Средиземноморской конференции по встроенным вычислениям (MECO 2012), Бар, Черногория, 2012;

Конференции, посвященной сложности генома, проводимой в рамках Европейской конференции по сложным системам, Брюссель, Бельгия, 2012 и межлабораторном семинаре Центра «Биоинженерия» РАН, Москва, 2015.

Публикации по теме диссертации По материалам диссертации опубликовано 15 печатных работ, из них 5 работ - в рецензируемых научных изданиях и 10 - в материалах научных конференций.

Статьи в рецензируемых научных журналах:

1. Suvorova Y. M., Rudenko V. M., Korotkov E.V. Detection change points of triplet periodicity of gene // Gene. 2012. V. 491, P. 58-64.

2. Суворова Ю. М., Короткова М. А., Коротков Е. В. Изучение точек разладки триплетной периодичности в нуклеотидных последовательностях генов // Прикладная информатика. 2012. Т. 5. С.

75-89.

3. Суворова Ю. М., Коротков Е. В. Изучение геномной специфичности триплетной периодичности генов прокариот // Вестник НИЯУ МИФИ. 2014. Т. 3(2). С. 232-239.

4. Suvorova, Y. M., Korotkova M.A., Korotkov E. V. Study of the Paired Change Points in Bacterial Genes // IEEE/ACM Trans Comput Biol Bioinform. 2014. V. 11(5) С. 955 – 964.

5. Suvorova Y. M., Korotkov E. V. Study of triplet periodicity differences inside and between genomes. // Statistical Applications in Genetics and Molecular Biology. 2015. Vol. 14 №2. С. 113-123.

Публикации в трудах конференций:

6. Суворова Ю.М., Коротков Е. В. Поиск склеенных генов в банке данных KEGG // Сборник трудов международной конференции “Новые информационные технологии в медицине, биологии, фармакологии и экологии”. Гурзуф. 2010. C 138-139.

7. Суворова Ю. М., Коротков Е. В. Изучение склеенных генов в банке данных KEGG // Сборник трудов III международной конференции “Математическая биология и биоинформатика”. Пущино. 2010. С 133Suvorova Y. M., Korotkov E. V. Detecting genes with triplet periodicity splicing // Proceed. The International Moscow Conference On Computational Molecular Biology (MCCMB’11). Москва. 2011 P. 358-359.

9. Suvorova Y.M., Korotkov E.V. Splicing of the triplet periodicity in genes from different species. // Proc. of the 6th International Symposium on Health Informatics and Bioinformatics (HIBIT 2011). Измир 2011. P. 245Suvorova Y. M., Korotkov E. V. Changes of triplet periodicity in coding sequences // Abstr. The 4th international IMBG Conference For Young Scientists "Molecular Biology: Advances And Perspectives", Киев.

2011. P. 197.

11. Суворова Ю. М., Коротков Е. В. Метод поиска точек разладки в последовательностях генов. // Научная сессия НИЯУ МИФИ-2012 Москва. 2012. Т. 3. С. 146

12. Суворова Ю. М., Коротков Е. В. Анализ распределения триплетной периодичности между генами одного генома // IV Международная конференция “Математическая биология и биоинформатика”, Пущино. 2012. С. 61-62.

13. Коротков Е. В., Суворова Ю. М. Изучение одиночных и парных точек разладки в кодирующих последовательностях ДНК // V съезд биофизиков России, Нижний Новгород. 2012. Том. 1. С. 383

14. Suvorova Y., Korotkov E. Change points in DNA coding sequences // Mediterranean Conference on Embedded Computing. Бар. 2012. P. 251 - 254

15. Suvorova Y. M., Korotkova M.A., Korotkov E.V. Search of Possible Insertions in Bacterial Genes. // International Conference on Bioinformatics Models, Method and Agorithms. Анже. P.99-108 Структура и объем диссертации Диссертация состоит из введения, трех глав, выводов и списка литературы. Общий объем работы составляет 135 страниц, в том числе 28 рисунков, 7 таблиц и список литературы из 142 наименований.

–  –  –

В данном литературном обзоре будут подробно рассмотрены методы изучения периодичности символьных последовательностей, в частности методы изучения триплетной периодичности белоккодирующих последовательностей. В том числе методы поиска участков, содержащих триплетную периодичность в последовательности, работы изучающие причины возникновения триплетной периодичности и способы ее применения. Освещены также методы поиска точек разладки и работы, применяющие их к последовательностям ДНК. А также исследования, посвященные эволюции генов, которые приводят к идее о связи между точками разладки триплетной периодичности генов с их эволюционным происхождением.

1.2 Краткий обзор задач и методов компьютерного анализа последовательностей ДНК За последние десятилетия для анализа нуклеотидных последовательностей создано большое число методов, направленных на решение различных задач. С точки зрения компьютерного анализа последовательность ДНК чаще всего представляет собой символьную последовательность (S) четырех буквенного алфавита A. Каждая буква соответствует одному из оснований ДНК: аденин [A], гуанин [G], цитозин [C] и тимин [T]. В некоторых алгоритмах вводятся сокращенные версии алфавита, полученные в результате объединения нуклеотидов в группы по различным биохимическим принципам. Три самых распространенных правила для построения сокращенных алфавитов:

–  –  –

Одно из центральных понятий, используемых в биоинформатике понятие подобия последовательностей. Оно подразумевает, что символьное подобие последовательностей ДНК отражает функциональное, структурное и эволюционное сходство между ними (и кодируемыми белками), а существующие различия были приобретены в процессе эволюции. Таким образом, если есть некоторая последовательность, о которой ничего неизвестно и есть другая последовательность похожая на нее с известными свойствами, то на основании этого сходства можно предсказать структуру, функции или эволюционное происхождение неизвестной последовательности. Потому одной из первых задач стало создание алгоритмов и программ, позволяющих выявлять уровень подобия между двумя (и более) последовательностями (задача выравнивания).

Выравнивание – один из основных инструментов, используемый современной биоинформатикой. Выравнивание (двух или более) последовательностей – это процедура сопоставления символов последовательностей, при котором достигается максимальный уровень подобия (максимум функции сходства). Эта процедура основана на методе динамического программировании с использованием весовых матриц [Durbin и др., 1998] и системы штрафов. Весовые матрицы представляют собой симметричную квадратную матрицу, ячейки которой – это веса, задающие уровень сходства между отдельными символами алфавита. При этом разрешается вставлять в последовательность специальный «пустой» символ, называемый делецией. При таком подходе система оценки (весовая матрица и система штрафов) играет большую роль, так как эта система должна отдавать предпочтение биологически правильному выравниванию.

Существуют методы глобального [Needleman, Wunsch, 1970] (когда последовательности выравниваются от начала до конца), и локального [Smith, Waterman, 1981a] выравнивания (которое подразумевает поиск наиболее похожих участков). Также для ускорения процесса поиска подобий в больших базах данных (классические методы динамического программирования при выравнивании двух последовательностей длиной M и N требуют O(MN) памяти и столько же времени) используются различные эвристические подходы.

1.2.1 Методы анализа последовательностей, не основанные на выравниваниях Программы выравниваний не только исторически являются одними из первых программ анализа биологических последовательностей, но также лежат в основе многих других алгоритмов и методов этой области.

Так программа построения выравниваний, основанная на эвристическом алгоритме, BLAST, пожалуй, самый популярный инструмент современной биоинформатики - согласно Google на исходную статью 1990 года [Altschul и др., 1990] насчитывается более 40 000 ссылок. Однако, не смотря на все это, возможности выравниваний ограничены. Так по данным [Loewenstein и др., 2009] программы аннотации на основе анализа последовательностей могут покрыть до 70% белков, представленных в банке данных аминокислотных последовательностей UniProt. Это ограничение связанно с тем, что в процессе эволюции последовательностей предковые формы не сохранились или исходное сходство, было утеряно в результате мутаций. Поэтому в последнее время все чаще предпринимаются попытки создания алгоритмов анализа последовательностей, не использующих выравниваний так называемых “alignment-free”методов [Bonham-Carter, Steele, Bastola, 2013; Kantorovitz, Robinson, Sinha, 2007;

Vinga, 2014; Vinga, Almeida, 2003]. Создатели таких программ используют для решения задач только статистические свойства самой символьной последовательности. Этот подход особенно часто используется при поиске регуляторных последовательностей, т.к. для многих из них известны специфические мотивы. Существуют такие программы и для филогенетических исследований [Stuart, Moffett, Baker, 2002], сравнения последовательностей [Borozan, Watt, Ferretti, 2015; Yin, Chen, Yau, 2014]. Однако по сравнению с методами, использующих выравнивания, их доля пока невелика.

1.3 Определение периодических последовательностей Известно, что периодические явления, регистрируемые “математическими методами” могут отражать внутренние свойства самого объекта. Существует множество исследований, посвященных изучению периодических явлений не только в последовательностях ДНК, но и в музыке, текстах на естественных языках, компьютерных программах, экономических данных и многих других типах последовательностей.

Периодические последовательности имеют меньшую сложность, по сравнению со случайными последовательностями (так называемыми последовательностями Бернулли). Последовательность Бернулли - это последовательность, в которой появление каждого следующего символа случайно и не зависит от контекста, т.е. от остальных символов последовательности (в классическом определении также все символы имеют равную вероятность появления). Это означает, что вероятность найти подпоследовательность s1s2...sn длины n равна произведению вероятностей появления составляющих ее символов:

–  –  –

где H1 средняя неопределенность одного символа.

В отличие от случайных последовательностей, периодические последовательности обладают меньшей степенью неопределенности.

Основным свойство периодических последовательностей является зависимость символов внутри последовательности – внутренняя корреляция. Пример периодической последовательности с периодом три:

S = “ATCATCATCATCATCATCATCATCATCATC”

Последовательность S содержит десять повторов паттерна “ATC” (так называемый, тандемный повтор).

То, что в реальных последовательностях периодичность не явно выраженная, а представляет собой, так называемую размытую или скрытую периодичность является основным препятствием для ее обнаружения. В случае скрытой периодичности каждая позиция периода может принимать значение из некоторого набора символов [Korotkov, Korotkova, Kudryashov, 2003]. Модель такой последовательности с периодом в три символа можно записать в виде {A,C}{T}{A,C,G}, например

S = “ATCCTGCTCCTGATCCTCATGATCATCCTG”

Последовательность, обладающая скрытой периодичностью, с точки зрения теории информации лежит между полностью случайной Бернулевской последовательностью, обладающей максимальной энтропией, и избыточной последовательностью простого повтора.

Триплетная периодичность

Примерно с того момента, как стали доступны для исследования первые генетические последовательности, было обнаружено, что эти последовательности содержат различные типы периодичности. Размер периода при этом может быть очень разным. Известны совсем короткие периоды – например, три, в кодирующих последовательностях [Fickett, Tung, 1992]; периоды средней длины, например, период в 10-11 пар оснований, связанный со структурой молекулы ДНК [Herzel, Weiss, Trifonov, 1999]; до очень протяженных периодических мотивов в геномах теплокровных позвоночных, так называемые изохоры [Bernardi и др., 1985]. Периодичность различной длины и различной степени выраженности существует как на геномном так и протеомном уровне, в кодирующих и некодирующих районах, представлены как явные, так и размытые (скрытые) повторы [Trifonov, Sussman, 1980]. Для многих из найденных вариантов периодичности было выявлено ее биологическое значение. Одним из самых известных типов периодичности – является триплетная периодичность (и другие периодичности, периоды которых кратны трем) последовательностей ДНК, кодирующих белки.

Периодичность можно условно разделить на две категории:

тандемные повторы и периодические осцилляции (здесь и далее [Zhang и др., 2007]). Тандемный повтор si si 1si 2...si 2 p 1 причем si j si p j.

Распознавание тандемных повторов в условиях размытия их мутациями типа вставок и делеций, особенно при условии, что сам паттерн (или мотив) и даже размер периода заранее не известен, представляет собой довольно сложную задачу. Второй, более сложный тип периодичности это осцилляции символов. Когда сложно выделить какой-то паттерн, но существует статистически значимая корреляция между символами на определенных позициях последовательности. В таком случае совместная вероятность двух символов уже не равна произведению их вероятностей.

Свойство триплетной периодичности кодирующих последовательностей чаще всего можно отнести именно ко второму типу.

Одним из первых свойство триплетной периодичности обнаружил Фикетт [Fickett, 1982]. В своей работе он подсчитал частоты встречаемости пар из двух тиминов, разделенными между собой k символами для различных значений k. Автор также рассчитал аналогичные частоты для случайной модели. Сравнивая результаты, он выяснил, что в кодирующих участках значения, полученные на реальных последовательностях, значительно отличались от модели (при значениях k 2,5,...(2 3n) ). В тоже время некодирующие районы таким свойством не обладали. Из чего автор заключил, что триплетная периодичность – универсальное отличие кодирующих районов от некодирующих.

В дальнейшем сделанное открытие было подтверждено методами, использующими преобразование Фурье. Если последовательности ДНК представить в цифровом виде, то анализ Фурье показывает, что спектры кодирующих областей генома достигают максимума при частотах, соответствующих периоду три, в то время как в некодирующих областях генома такие пики отсутствуют. Впоследствии для измерения триплетной периодичности были использованы многие математические методы, обзор которых приведен ниже. Принципиально то, что все методы подтвердили наличие в кодирующих последовательностях различных организмов (начиная от бактерий до высших позвоночных) свойство триплетной периодичности.

1.4 Методы исследования триплетной периодичности За последние десятилетия были разработаны различные методы для определения наличия периодичности в последовательности, некоторые из которых освещены в данном обзоре.

Корреляционные функции Одними из первых математических методов, изучающих периодические свойства биологических последовательностей, были корреляционные методы. Корреляционные методы можно использовать, как переводя символьную последовательность в числовую, так и применяя их непосредственно к самой последовательности. Простейший случай – это автокорреляция символьной последовательности S для длины периода d, которая рассчитывается непосредственно из последовательности, следующим образом [Afreixo, Ferreira, Santos, 2004]

–  –  –

В других работах последовательности ДНК описывались при помощи набора корреляционных функций. В качестве меры непосредственного определения корреляции между основаниями в последовательностях ДНК были предложены 16 корреляционных функций (измеряющих корреляцию между всеми возможными парами

–  –  –

Где Pij (d ) совместная вероятность наблюдения нуклеотидов типа i и j на расстоянии k, а Pi и Pj - плотности распределения нуклеотидов соответствующего типа.

Так как в реальных исследованиях корреляционная функция вычисляется для последовательностей конечной длины, большую роль играет метод оценки вероятностей. Такая оценка должна минимизировать ошибку для случая конечной выборки. Существуют несколько вариантов оценки (подробное описание приводится в работе [Li, 1997]). Самая простая - частотная оценка:

–  –  –

где N i, N j - числа встречаемости соответствующих оснований, N общее число символов в последовательности.

Другой способ подразумевает выполнение байесовских оценок.

–  –  –

Последняя оценка, называемая direct Bayesian estimator, по оценке [Grosse, 1996] обладает наименьшим разбросом.

К недостаткам методов, основанных на корреляции, относится то, что часто помимо основного периода d пики возникаю на кратных периодах (2d, 3d, …) [Epps 2011]. Также корреляционные методы теряют свою эффективность в присутствии вставок и делеций.

Методы, основанные на преобразовании Фурье Методы, использующие преобразования Фурье, широко применяются для анализа временных рядов, а также символьных последовательностей, в том числе и для поиска скрытой периодичности [Afreixo, Ferreira, Santos, 2004; Лобзин, Чечеткин, 2000].

Для того, чтобы можно было применить спектральный подход, в первую очередь, символьная последовательность ДНК должна быть каким-то образом представлена в виде цифровой последовательности.

Один из вариантов такого представления состоит в разложении одной последовательности ДНК на четыре цифровых сигнала (по одному для каждого типа нуклеотида j) с использованием, так называемой, единичной функции:

–  –  –

Величина N, размер окна, должна быть кратна периоду, т.е. в случае триплетной периодичности, кратна трем. Это так называемое оконное преобразование Фурье. Пусть k N / 3, последовательность может быть представлена в виде нормализованных коэффициентов:

–  –  –

позволяет отделить кодирующие области от некодирующих [Silverman, Linsker, 1986; Tiwari и др., 1997]. Позже [Anastassiou, 2000] усовершенствовал меру, добавив в нее четыре веса

–  –  –

которые выбирались с помощью обучающей выборки на известном геноме. Введенные веса дают возможность не просто измерять интенсивность периодичности, но и позволяют создать ее профиль для некоторого генома. Усовершенствованная мера позволила автору получить лучшие результаты при поиске кодирующих последовательностей в геноме S.cereviasie [Anastassiou, 2000] по сравнению с простым оконным методом.

В дальнейшем авторы работы [Kotlar, Lavner, 2003] предложили для поиска кодирующих районов меру (Spectral rotation measure), учитывающую фазы четырех комплексных компонент, а именно:

arg(U A ( N / 3)); arg(U T ( N / 3)); arg(U C ( N / 3)); arg(U G ( N / 3)) (16)

Авторы показали, что форма распределения фазовой составляющей этих компонент для кодирующих регионов некоторого генома имеет форму колокола, в то время как распределение этих величин для некодирующих районов близко к равномерному распределению.

Похожая модель, учитывающая фазу комплексных компонент, была позже применена для поиска сдвига рамки считывания в гене [Masoom и др., 2006].

Другой подход, использующий преобразование Фурье, подразумевает разложение автокорреляционной функции. Авторы работ [Makeev, Tumanyan, 1996; Makeev V.Y., Frank G.K., Tumanyan V.G, 1996] использовали матрицу Фурье для исследования периодов в различных символьных последовательностях

–  –  –

Изучая с помощью данного метода периодичность различных длин периода (от 2 до 10 нуклеотидов) в кодирующих и некодирующих районах авторы [Makeev V.Y., Frank G.K., Tumanyan V.G, 1996] показали, что именно период в три символа является отличительным для кодирующих последовательностей.

Существует связь между преобразованием Фурье единичной функции и преобразованием автокорреляционной функции [Afreixo, Ferreira, Santos, 2004] [Chechetkin, Turygin, 1994]. Однако методы, основанные на преобразовании Фурье обладают одним преимуществом, они позволяют визуализировать спектр, что иногда помогает легче установить периодические зависимости, по сравнению с корреляционными функциями. К недостаткам методов, основанных на преобразовании Фурье, можно отнести зависимость результата разложения от представления символьной последовательности в числовом виде [Afreixo, Ferreira, Santos, 2004], влияние кратных периодов и невозможность определять периодичность при наличии сдвигов фазы (мутаций сдвига рамки считывания).

Адаптивное преобразование Фурье Для того, чтобы можно было применить к последовательности ДНК метод, основанный на преобразовании Фурье, символьная последовательность должна быть преобразована в числовую последовательность. Переход от символьной последовательности к числовой может скрывать или наоборот наводить некоторые свойства периодической последовательности. Кроме того, большинство методов предлагает один тип преобразования для любой последовательности ДНК. Метод адаптивного преобразования Фурье (spectral envelope) был создан для того, чтобы преодолеть этот недостаток простого метода Фурье при анализе символьных последовательностей. В данном случае перекодировка каждый раз подбирается таким образом, чтобы оптимизировать показатели преобразования для каждой частоты в отдельности. Суть метода адаптивного преобразования Фурье [Stoffer,

–  –  –

по всем возможным не пропорциональным 1k (identity map that maps all letters to 1). Этот метод был также ранее применен для анализа последовательностей ДНК [Stoffer, Tyler, McDougall, 1993], в частности, для анализа триплетной периодичности [Howe, Song, 2013].

Гибридный метод Недавно для поиска периодичности был предложен гибридный метод, сочетающий в себе свойства автокорреляции и преобразования Фурье для того, чтобы преоодолеть трудности методов, связаннные с кратными периодами [Epps, 2009; Epps, Ying, Huttley, 2011]:

Hybrid ( p ) CORR( p) X p (20)

–  –  –

Для расчета автокорреляции и преобразования Фурье последовательность ДНК переводится в бинарную числовую последовательность, в которой на 1 заменяется интересующий символ (или символы), 0 – все остальные символы.

Авторы показали на модельных и реальных последовательностях, что для различных длин периодов данный метод показывает лучший результат, чем просто автокорреляционная функция или целочисленное преобразование Фурье [Bellani, Epps, Huttley, 2012; Epps, Ying, Huttley, 2011].

Вэйвлет-преобразования Как уже было сказано, триплетная периодичность может быть определена с помощью преобразования Фурье [Anastassiou, 2000].

Однако способность метода определить точные границы триплетной периодичности ограничена выбором размера окна, на котором рассчитываются спектры. Было показано, что выбор окна сильно влияет на точность. В качестве улучшения оконного преобразования Фурье было предложено использовать метод вэйвлет-преобразования (wavelet transform) [Добеши, 2001].

Вэйвлет-преобразование непрерывной функции u(x) выражается следующим интегралом

–  –  –

Авторы работы [Wang, Stein, 2010] модифицировали функцию Морле, введя в нее дополнительный параметр, для анализа триплетной периодичности последовательностей ДНК. Новый метод позволил авторам более точно находить границы участков с периодичностью, при этом регистрируя древние сдвиги рамки считывания в гене.

Блуждания Другим визуальным методом для изучения закономерностей в последовательностях является так называемый метод случайных блужданий (random walks) или ДНК-блужданий (dna-walks). В статье [Peng и др., 1992] нуклеотидная последовательность сначала переводится в бинарную (например, пурины заменяются на 1, а пиримидины на -1). Полученная бинарная последовательность представляется в виде блужданий ( X (k ) 1, означает движение вверх, X (k ) 1 – движение вниз). В такой нотации случайные бинарные последовательности представляют собой случайные блуждания.

Блуждания наглядно показывают, обогащенность последовательности тем или иным типом оснований, а также случайность или зависимость следования символов. Можно вычислить результирующее значение сканирующей статистики для некоторого фиксированного окна длины L:

–  –  –



Pages:   || 2 | 3 | 4 |
Похожие работы:

«Масленников Андрей Геннадьевич РАЗРАБОТКА МЕТОДА ОБРАБОТКИ ТРАФИКА В ОЧЕРЕДЯХ МАРШРУТИЗАТОРОВ МУЛЬТИСЕРВИСНОЙ СЕТИ НА ОСНОВЕ НЕЧЁТКОЙ ЛОГИКИ Специальность 05.12.13 — Системы, сети и устройства телекоммуникаций Диссертация на соискание учёной степени кандидата технических наук Научный руководитель: кандидат технических наук Деарт В.Ю. Москва – 2015 Оглавление Стр. Введение............................»

«ЕРУСАЛИМСКИЙ ЯКОВ МИХАЙЛОВИЧ РАЗРАБОТКА И ИССЛЕДОВАНИЕ МЕТОДОВ РЕШЕНИЯ ЭКСТРЕМАЛЬНЫХ ЗАДАЧ НА ОРИЕНТИРОВАННЫХ ГРАФАХ И СЕТЯХ С ОГРАНИЧЕНИЯМИ НА ДОСТИЖИМОСТЬ Специальность: 05.13.17 – теоретические основы информатики диссертация на соискание ученой степени доктора технических наук Ростов-на-Дону, 2015 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ....»

«ВАЙСМАН ДАВИД ШУНЕВИЧ СОВЕРШЕНСТВОВАНИЕ СИСТЕМЫ ИНФОРМАЦИОННОГО ОБЕСПЕЧЕНИЯ ОЦЕНКИ И АНАЛИЗА СМЕРТНОСТИ НАСЕЛЕНИЯ НА УРОВНЕ СУБЪЕКТА РОССИЙСКОЙ ФЕДЕРАЦИИ 14.02.03 – Общественное здоровье и здравоохранение Диссертация на соискание ученой степени доктора медицинских наук Научный консультант: доктор медицинских наук, профессор И.М....»

«Шаталов Павел Сергеевич СИСТЕМА ПОДДЕРЖКИ ПРИНЯТИЯ РЕШЕНИЙ ПО УПРАВЛЕНИЮ ПРИРОДНЫМИ ПОЖАРАМИ С ИСПОЛЬЗОВАНИЕМ ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛИТЕЛЬНЫХ СИСТЕМ И ДАННЫХ КОСМИЧЕСКОГО МОНИТОРИНГА 05.13.01 Системный анализ, управление и обработка информации (информатика, вычислительная техника, управление) Диссертация на соискание ученой степени...»

«САВОСТЬЯНОВА ИРИНА ЛЕОНИДОВНА МЕТОДИЧЕСКАЯ СИСТЕМА ФОРМИРОВАНИЯ ПРОФЕССИОНАЛЬНОЙ ИНФОРМАЦИОННОЙ КОМПЕТЕНТНОСТИ БУДУЩИХ БАКАЛАВРОВ-ЭКОНОМИСТОВ В ДИСЦИПЛИНАХ ИНФОРМАЦИОННОГО ЦИКЛА 13.00.02 – Теория и методика обучения и воспитания (информатика, уровень высшего профессионального образования) Диссертация на соискание ученой степени кандидата...»

«Федосеева Марина Васильевна СЕТЕВЫЕ СООБЩЕСТВА КАК СРЕДСТВО ОРГАНИЗАЦИИ УЧЕНИЧЕСКОГО САМОУПРАВЛЕНИЯ 13.00.02 — теория и методика обучения и воспитания (информатизация образования) Диссертация на соискание ученой степени кандидата педагогических наук Научный руководитель академик РАО, доктор педагогических наук, профессор Кузнецов А.А. МОСКВА 201...»

«Биричевский Алексей Романович Аппаратно-программные методы защиты информации в мобильных устройствах телекоммуникационных и информационных систем Специальность 05.13.19 – Методы и системы защиты информации, информационная безопасность Диссертация на соискание ученой степени Кандидата технических наук Научный руководитель д.т.н,...»

«МЕЩЕРЯКОВ Олег Александрович МОДЕЛИ И АЛГОРИТМЫ МНОГОКРИТЕРИАЛЬНОГО ВЫБОРА СИСТЕМ ПЛАНИРОВАНИЯ РЕСУРСОВ АГРОПРОМЫШЛЕННЫХ ПРЕДПРИЯТИЙ Специальность 05.13.17 – теоретические основы информатики Диссертация на соискание ученой степени кандидата технических наук Научный руководитель: доктор технических наук, доцент Чулков В.А. ПЕНЗА – 2015 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ.. АНАЛИЗ ПРОБЛЕМ ИНФОРМАЦИОННОУПРАВЛЕНЧЕСКОГО...»

«Морозов Роман Викторович МОДЕЛЬ И МЕТОДЫ ИНТЕЛЛЕКТУАЛЬНОЙ ПОДДЕРЖКИ ПРИНЯТИЯ УПРАВЛЕНЧЕСКИХ РЕШЕНИЙ ПО ПОЖАРНОЙ БЕЗОПАСНОСТИ ЗДАНИЙ СФЕРЫ ОБРАЗОВАНИЯ 05.13.01 – Системный анализ, управление и обработка информации (информатика, вычислительная техника и управление) Диссертация на соискание ученой степени кандидата технических наук Научный...»

«Конорев Максим Эдуардович ВИРТУАЛЬНЫЙ ИСТОРИЧЕСКИЙ АРХИВ КАК СРЕДСТВО ИНФОРМАТИЗАЦИИ ИСТОРИЧЕСКОГО ОБРАЗОВАНИЯ ПРИ ПОДГОТОВКЕ БАКАЛАВРОВ В ВУЗЕ 13.00.02 – теория и методика обучения и воспитания (информатизация образования) Диссертация на соискание ученой степени кандидата педагогических наук Научный руководитель: доктор педагогических...»

«ПРОСЯННИКОВ МИХАИЛ ЮРЬЕВИЧ МЕДИКО-ЭКОНОМИЧЕСКАЯ ЭФФЕКТИВНОСТЬ СТАНДАРТИЗИРОВАННОЙ ПРОГРАММЫ ДИАГНОСТИКИ И ЛЕЧЕНИЯ ДОБРОКАЧЕСТВЕННОЙ ГИПЕРПЛАЗИИ ПРЕДСТАТЕЛЬНОЙ ЖЕЛЕЗЫ 14.02.03 Общественное здоровье и здравоохранение Диссертация на соискание ученой степени кандидата медицинских наук НАУЧНЫЕ...»

«Рафикова Юлия Юрьевна ГЕОИНФОРМАЦИОННОЕ КАРТОГРАФИРОВАНИЕ РЕСУРСОВ ВОЗОБНОВЛЯЕМЫХ ИСТОЧНИКОВ ЭНЕРГИИ (на примере Юга России) Диссертация на соискание ученой степени кандидата географических наук Специальность 25.00.33 «Картография» Научный руководитель Доктор географических наук, профессор Б.А. Новаковский Москва 201 Содержание Введение.. Глава 1....»

«Шереужев Мурат Альбертович Совершенствование товародвижения на рынке подсолнечного масла Специальность: 08.00.05. – Экономика и управление народным хозяйством (экономика, организация и управление предприятиями, отраслями, комплексами: АПК и сельское хозяйство) Диссертация на соискание ученой степени кандидата экономических...»

«АКСЕНОВ Алексей Юрьевич МОДЕЛИ И МЕТОДЫ ОБРАБОТКИ И ПРЕДСТАВЛЕНИЯ СЛОЖНЫХ ПРОСТРАНСТВЕННЫХ ОБЪЕКТОВ Специальность 05.13.01 – Системный анализ, управление и обработка информации (технические системы) Диссертация на соискание ученой степени кандидата технических наук Научный руководитель: доктор технических наук, Кулешов С.В....»

«НИКОНОРОВ Артем Владимирович ТЕОРЕТИЧЕСКИЕ ОСНОВЫ ВОССТАНОВЛЕНИЯ ЦВЕТНЫХ И...»

«Андреева Надежда Михайловна МЕТОДИКА ИСПОЛЬЗОВАНИЯ ДОРОЖНЫХ КАРТ ПРИ ЭЛЕКТРОННОМ ОБУЧЕНИИ СТУДЕНТОВ ИНФОРМАТИКЕ (на примере экономических и биологических направлений подготовки) 13.00.02 – Теория и методика обучения и воспитания (информатика, уровень профессионального образования) ДИССЕРТАЦИЯ на соискание учёной степени кандидата...»

«Орлов Юрий Львович ПОЛНОГЕНОМНЫЙ КОМПЬЮТЕРНЫЙ АНАЛИЗ РАСПРЕДЕЛЕНИЯ САЙТОВ СВЯЗЫВАНИЯ ТРАНСКРИПЦИОННЫХ ФАКТОРОВ ЭУКАРИОТ ПО ДАННЫМ ИММУНОПРЕЦИПИТАЦИИ ХРОМАТИНА И ВЫСОКОПРОИЗВОДИТЕЛЬНОГО СЕКВЕНИРОВАНИЯ 03.01.09 – математическая биология, биоинформатика Диссертация на соискание ученой степени доктора биологических наук Научный консультант: академик...»

«Денисов Дмитрий Вадимович АНТЕННЫЕ И ДИФРАКЦИОННЫЕ ХАРАКТЕРИСТИКИ ЛИНЗ ЛЮНЕБЕРГА ПРИ ОБЛУЧЕНИИ ПОЛЕМ КРУГОВОЙ ПОЛЯРИЗАЦИИ Специальность 05.12.07 – Антенны, СВЧ устройства и их технологии Диссертация на соискание ученой степени кандидата технических наук Научный руководитель – доктор технических наук, профессор Панченко Б.А. Екатеринбург – 2015...»

«Конфектов Михаил Николаевич Картографирование типов застройки Подмосковья по космическим снимкам Диссертация на соискание ученой степени кандидата географических наук по специальности 25.00.33 картография Научный руководитель: в. н. с., д. г. н. Кравцова В. И. Москва, 2015 Содержание ВВЕДЕНИЕ 1. ГЕОГРАФИЧЕСКИЕ И ИСТОРИЧЕСКИЕ УСЛОВИЯ ФОРМИРОВАНИЯ ЗАСТРОЙКИ...»

«ВОРОБЬЕВ МИХАИЛ ВИКТОРОВИЧ НАУЧНОЕ ОБОСНОВАНИЕ СИСТЕМЫ ОБЕСПЕЧЕНИЯ ИНФЕКЦИОННОЙ БЕЗОПАСНОСТИ МЕДИЦИНСКОГО ПЕРСОНАЛА И ПАЦИЕНТОВ ПРИ ОКАЗАНИИ СТОМАТОЛОГИЧЕСКОЙ ПОМОЩИ 14.02.03 – Общественное здоровье и здравоохранение Диссертация на соискание ученой степени доктора медицинских наук Научный консультант: д.м.н., профессор М.А. Иванова...»









 
2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.